M5 stimulation strongly induced YAP nuclear translocation on all substrates ( Figures S4A and S4B). This could explain the observed differences between the average YAP nucleus-to-cytoplasm ratio numbers in control monolayer cultures and control RHEs. We also observed a trend for more cytoplasmic YAP localization but higher overall expression with the decrease of substrate stiffness. Control cells formed smaller colonies while grown on very soft hydrogels (0.5 kPa) compared with colonies on the 12 or 50 kPa substrates. To test the role of the substrate rigidity in the inflammation-induced phenotypes, we plated N/TERT keratinocytes onto the hydrogels of various stiffness, coated with collagen IV ( Figure S4). Whereas monolayer cultures are supported by the rigid substrate (approximately 60 GPa for glass), the cells within the stratified epidermal layer are engaged by a much softer environment of lower cell layers (at 5–15 kPa range). We hypothesized that the differences in MLC activation and YAP nuclear targeting in monolayers versus RHE cultures may at least partially be explained by the differences in the stiffness of the cell environment. Using a specific inhibitor KD025, we show that ROCK2 executes its effects via cytoskeletal and transcription-dependent mechanisms to shape the inflammatory response in the epidermis. The inflammation-induced disruption of AJs, increased paracellular permeability, and YAP nuclear translocation are regulated by ROCK2, independently from myosin II activation. The integrity of cell-cell adhesion but not the myosin II contractility per se is the determinative factor for the YAP regulation in epidermal keratinocytes. We show that the inflammation upregulates the Rho-myosin II pathway and destabilizes adherens junctions (AJs) promoting YAP nuclear entry. Here we addressed this question by inducing a psoriatic phenotype in human keratinocytes and reconstructed human epidermis using a cytokine stimulation model. However, the cytoskeletal mechanisms regulating inflammatory responses in the epidermis are not well understood. The round brackets surround the name of the primer, and the sequence is written in the 5' to 3' direction.īefore submitting, make sure your preferences below are set correctly.Aberrant mechanotransduction and compromised epithelial barrier function are associated with numerous human pathologies including inflammatory skin disorders. Input limit is 200,000,000Ĭagctggggggaggtggcgaggaagatgacgtggtcgaggtcgacggtatcgagttgtcgcggcagctgccaatacgactcactatagaggagaagtagcaagaaaaataacatgataattatcacgacaactacctggtgatgttgctagtaatattacttgttatttttctcgtcatcttcccggcgacgtcgccagcaacatctttagtgagggttaatcacctgctacttctcccgccacctcccīelow are Microsynth's standard primers that are available free of charge for Sanger sequencing. Paste a raw sequence or one or more FASTA sequences into Primer Map supports the entire IUPAC alphabet and Use this program to produceĪ useful reference figure, particularly when you haveĭesigned a large number of primers for a particular RestrictionĮndonuclease cut sites, and the protein translations of theĭNA sequence can also be shown. Showing the annealing positions of PCR primers. Primer Map accepts a DNA sequence and returns a textual map
0 Comments
Leave a Reply. |
AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |